deveonellis123 deveonellis123
  • 04-02-2018
  • History
contestada

Muslim caliphates impacted Africa by

Respuesta :

garydesir1
garydesir1 garydesir1
  • 04-02-2018
Hello there!


Muslim caliphates impacted Africa by helping to establish a trade network to India and China.


As always, I am glad to be your helper today!
Answer Link

Otras preguntas

At the time that Sam began his climb up Mt Everest, it was −3°F at the base of the mountain. He knows that the temperature will drop 1 degree for every 500 feet
Can u plzz the answer the question in the pic.
2sinx+1 = 0 help me :v
How many solutions does this equation have? –7g − 6 + 19g = –g + 20
Olivia prepared 30 kilograms of dough after working 6 hours. How much dough did Olivia prepare if she worked for 10 hours? Solve using unit rates.
Describe two different ways to use the properties of exponents to rewrite the numerator of the expression. ASAP will mark as Brainliest
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Please help… Reciprocal of 1/-15
If 9^2x = 27/3^x+2, then find the value of x(a) 1/6(b) 1)5(c) -2/3(d) 1/8​
How were slavery and indentured labor in the American colonies similar? A. both worked only in agriculture. B. both received wages for their work. C. both ha