maddyleal maddyleal
  • 01-02-2018
  • Geography
contestada

Today, navigators still reply on imaginary lines to get where they are going?
True or false

Respuesta :

Darklightning Darklightning
  • 01-02-2018
Hello Maddyleal 


Question: Today, navigators still reply on imaginary lines to get where they are going? 

Answer: True

Hope that helps
-Chris
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What were the driving forces behind the industrial revolution
i need help with this question
A generator stores electric current. Explain why you agree or disagree with this statement
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
what is the most common type of vegetation throughout Latin America
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
Round 46.895 to the nearest tenth
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place