gabcamp2337 gabcamp2337
  • 04-01-2018
  • Social Studies
contestada

Hangouts find out who someone has been talking to

Respuesta :

Kalahira
Kalahira Kalahira
  • 18-01-2018
Hangouts is an application created by Google. This communication service allows users to interact with one another through, video, voice or text whether individually with one another or within a group. This platform replaced Google Talks and is currently available for Android and IOS.
Answer Link

Otras preguntas

Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
what rule does static electricity follow
What was George Washington's nickname?
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
Solve the equation -10 + 3x + 5x = -56 ? ??
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
What was religion like in Shang China?
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5