Paisa123
Paisa123 Paisa123
  • 02-12-2017
  • English
contestada

Which sentences are examples of active learning

Respuesta :

ndurairajownkpq
ndurairajownkpq ndurairajownkpq
  • 02-12-2017
Active learning is participating in class and class discussions
Answer Link
briannahughes1 briannahughes1
  • 02-12-2017
Doing the work and participating in class
Answer Link

Otras preguntas

Which of the equations below could be the equation of this parabola?5Vertex(0,0)10A. x = 2y2B. y= 2x2C. y = -2x2O D. x = -2y2
5. Usa el método de cocientes parciales para hallar 1,032 ÷ 43.
Solve the following equationX-3(x+2)=4 X - 3 ( x + 2 ) = 4
Identify the values of a, b, and c. b =
which two points are midpoint between the x - intercept and each of the vertical asymptotes of the function y= 5 cot(1/4x)
Study the diagrams of circles A and B.Circle A has its center at A(1, 1) and passes through the point (5, 1).Circle B has its center at B(-5, 1) and passes thro
Function g is represented by the table.Which statement correctly compares the two functions?
NaOH to pure water. It releases OH: NaOH is a_____ and the pH will_____.
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.
AM radio signals are broadcast at frequencies between 550 kilohertz (kHz) and 1600 kilohertz. FM radio signals are broadcast at frequencies between 88.0 megaher