tmontefalcon6203 tmontefalcon6203
  • 04-09-2017
  • Business
contestada

Write an original phone greeting for each of these medical specialty offices ophthalmologist

Respuesta :

Kalahira
Kalahira Kalahira
  • 13-09-2017
Greetings, this is the ophthalmologist's office .... where all the solutions for your eyesight are in sight, we are busy helping to restore the vision of our patients, leave your message after the beep that will be briefly addressed
Answer Link

Otras preguntas

Compliant is to stubborn as excited is to
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
Solve the equation -10 + 3x + 5x = -56 ? ??
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
How much money, in dollars, does one mole of nickels represent?
a antonym for biosphere