OregelNando OregelNando

01-05-2017
Biology

contestada

Most homeostatic systems are ____? extrinsic, intrinsic, both, none of the above

Respuesta :

XXDEADINSIDEXX XXDEADINSIDEXX

01-05-2017

Both my friend both is it

Answer Link

Otras preguntas

Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61

I need help with this problem!

A sample of gas at 25ºc has a volume of 11 l and exerts a pressure of 660 mm hg. how many moles of gas are in the sample?

Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new

The tall woman was a (professional) athlete who always (laughed) during scary movies. Choose the two antonyms for the (bracketed words) expert / chuckled skill

A tree casts a shadow 32 ft long. at the same time, the shadow cast by a vertical 8-ft post is 4 ft long. find the height of the tree.

zimmerman note definition

The name for people who stay in one place like civilization of china and kroea

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

When did the eastern part of the Roman Empire fall?