AaylahZ18123 AaylahZ18123
  • 04-11-2022
  • Mathematics
contestada

Graph the equation by the translating y=|x|Y=|x+2|A. Graph a B. Graph c C. Graph d D. Graph b

Graph the equation by the translating yxYx2A Graph a B Graph c C Graph d D Graph b class=

Respuesta :

ArlonR42168 ArlonR42168
  • 04-11-2022
[tex]\text{The graph of y=|x+2| is graph a}[/tex]

Ver imagen ArlonR42168
Answer Link

Otras preguntas

in what area of Europe were the majority of warsaw pact countries
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
what might be learned from an incorrect hypothesis
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?