Kjc Kjc
  • 04-04-2014
  • Mathematics
contestada

what is the percent notation for 6.4%

Respuesta :

MathG33k
MathG33k MathG33k
  • 04-04-2014
I will edit this later on if this is wrong
6.4% = .064
Answer Link
Аноним Аноним
  • 04-04-2014
[tex]p\%=\frac{p}{100}\\\\6.4\%=\frac{6.4}{100}=\frac{64}{1000}=0.064[/tex]
Answer Link

Otras preguntas

A rectangle has an area of 384 m. The length and the width of a rectangle are changed by a scale factor of 0.75. What is the area of the new triangle
-6.8 + (-12) + (-72.3).
Which type of intelligence allows people to use their vision to develop mental images?
6. Which of the following is a consequence of chronic alcohol use? A. gastritis B. stomach ulcers C. heartburn D. All of the above
What is the value of x?
the volume of a sphere is 2254 pi ^3 what is the surface area of the sphere
(75) pointsPlease help me on these questions ASAP!!!
NEED HELP ASAPPPPPPP
The test scores for a group of students are shown. 89, 74, 100, 86, 74, 67, 86, 72, 60, 93, 83, 86 What is the median of the scores?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat