ehjshdjdhdhdbbd ehjshdjdhdhdbbd

03-02-2017
Mathematics

contestada

What is the answer this I really need to know

What is the answer this I really need to know class=

Respuesta :

gabsterlilly gabsterlilly

03-02-2017

The answer is 206 I'm pretty sure

Answer Link

Аноним Аноним

03-02-2017

It's 206, you multiply the original answer by two, then you have your answer. You can also double check

Answer Link

Otras preguntas

Please help serious answers only

1)Why did the US start to think of itself as the World’s Protector of Peace? and2)Explain how the act of imperialism/colonization could also be seen as the oppo

Which of the following is a fragment? A. The woman who had been our neighbor and family dentist for years. B. He liked it. C. The hotel only offered sweets and

You and your family went to Chick-Fil-A for dinner and the total bill was $27.95. Since you are a part of the Chick-Fil-A Club, you can get a 15% discount. Whic

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

the climax of the zoo by edward d. hoch

Which sequence shows the numbers in order from least to greatest?

Cuales son las flexiones mas fáciles para principiantes?

which two usda food groups are most likely to supply iron?

A company depreciate motor vehicle at 5% per annum. What will be the book value at the end of 3 years of a car which was bought at N250,500.00 ? Supposedly the