devvynn
devvynn devvynn
  • 02-11-2021
  • Mathematics
contestada

the question is in the image.

the question is in the image class=

Respuesta :

syahbanazacki
syahbanazacki syahbanazacki
  • 04-11-2021

Step-by-step explanation:

f(x) = 4x + 1

g(x) = x² - 5

(f+g)(x) = f(x) + g(x)

= (4x + 1) + (x² - 5)

= x² + 4x + (1 - 5)

= x² + 4x - 4

Option → C

Answer Link

Otras preguntas

For the right triangle with side of lengths 5 12 and 13, find the length of the radius of the inscribed circle
A man has blood type AB and his wife has blood type B. What are the possible blood types for their child
Express the area of a rectangle with length 7ab and width 2a as a monomial.
Help me please im about to give up
Which constitutional amendment allowed voting for citizens who were eighteen or older?
Somebody asked a teacher: ”How many students do you have? I would like to send my son to your school.” The teacher answered: “If as many students as I have now
please help me if you can, thank you!
Asexual reproduction _____. see concept 13.1 (page 255) asexual reproduction _____. see concept 13.1 (page 255) leads to a loss of genetic material requires bo
Everyone in the neighborhood has been complaining about the deteriorating condition of the park, but nobody has cleaned it up. why not
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat