nasseralhattali19
nasseralhattali19 nasseralhattali19
  • 01-11-2021
  • Chemistry
contestada

Define density of a substance.

Respuesta :

Banana3ana
Banana3ana Banana3ana
  • 01-11-2021

Answer: density is how compact a substance is

Explanation: the formula used to find density is d=m/v where d is density, m is mass and v is volume

Answer Link

Otras preguntas

NEED HELP PLEASE!!!!!!! The answers for the first arrow is 32, 33.6, 34, 35.4 The second arrow answers are $93.60, $94.20, $96.40, $97.80
HELP NEEDED !!!! A class's exam scores are normally distributed. If the average score is 65 and the standard deviation is 6, what percentage of students scored
What is foster’s overall point about journeys or trips in literature?
Read the following excerpt from Sandra Cisneros’s story "Mericans." They’re not from here. Ladies don’t come to church dressed in pants. And everybody knows me
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
difference between syntax and semantics
Please help me out with this
How did the cold war shape american culture in the late 1950s and 1960s? what was the most important impact?
Groups that are more formal and require less continuous interaction are known as what type of​ group?
epistrophe literary definition