aplechykova50
aplechykova50 aplechykova50
  • 04-05-2021
  • Mathematics
contestada

|x+3| if x>5
|x+3 if x>2
|x+3| if x=2
|x-3| if x>5
|120+x| if x<-120
PLS HELP ASAP

Respuesta :

arayahsmckoy
arayahsmckoy arayahsmckoy
  • 05-05-2021
What are you looking for?
Answer Link

Otras preguntas

Many worship services include a speech given by a church leader. this speech is called a
On The Magic School Bus, you find yourself traveling from Earth to the Moon. It is approximately 240 million miles. Once there, you realize you must turn 90 deg
Determine the number of real solutions each quadratic equation has. y = 12x2 - 9x + 4 __ real solution(s) 10x + y = -x2 + 2 __ real solution(s) 4y - 7 = 5x2 -
PLEASE HELP!! What was the 90-day wage and price freeze? A) a temporary freeze on wages, prices, and rents B) a sale to help the economy C) a
When you prepare to make a left turn from a one-way road into a two-way road, you must:?
If a family has three children, what is the probability that the family has at least one girl?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
how is an error within an EMR corrected
Which of the following do scientists think will probably cause Earth's next ice age?
When citizens _______, they help elect people who carry out government tasks. A. vote B. volunteer C. lobby D. nominate