citort58 citort58
  • 01-03-2021
  • Mathematics
contestada

HELP
WRITE AS EQUATION IR EXPRESSION
500 decreased by sum of a number and 2 is 300

Respuesta :

r3t40
r3t40 r3t40
  • 01-03-2021

[tex]500 - (2 + n) = 300[/tex]

Hope this helps.

Answer Link

Otras preguntas

Evaluate the function f(x) = - x^2 - 3 at the given value of the variable. a. f(2) b. f(-4)
What are the key elements of this story that help to build suspense? Use specific details from the narrative to support your answer. (1 point)
Choose the missing parts of the program to have the following output. pet: def __init__( ,strSpecies,strName): self.species = strSpecies self.petName = strN
the board game parcheesi is based on a game from what country?
solve for x!! helppppp
why does all the water of the earth not get evaporated during hot summer days?​
Can someone please help me with this question?
calculator to approximate 125.9. Round your answer to the nearest hundredth.
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Select the correct answer. Which part is inapproprlate language for formal writing? The batter was in doubt as to whether to bunt or to hit a line drive. OA. ba