Tamia022608 Tamia022608
  • 02-02-2021
  • Mathematics
contestada

Solve the proportion
20/3 = ?/6

Respuesta :

uwuboycute
uwuboycute uwuboycute
  • 02-02-2021

Answer:

40

Step-by-step explanation:

3 x 2 = 6 so then 20 x 2 = 40

Answer Link

Otras preguntas

(-6x^3+2x^2-2x)/(2x-1) how do I solve using long division?
__________ involves a rapid loss that occurs just before death. primary aging pathological aging secondary aging tertiary aging
__________ involves a rapid loss that occurs just before death. primary aging pathological aging secondary aging tertiary aging
Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)
If a car's __________ is malfunctioning, people in the car will become ill when driving long distances, especially if the windows are closed. A. braking system
what is r in this equation? πr^2=42π
how is mechanical weathering best described A. The buildup of chemical deposits on the surface B. The breakdown of rock through mechanical disintegration and ph
How far away is the next Earth-like planet in light years? What does this seem unlikely that it won’t be a manned space mission?
NEED HELP ASAPPPPPPP
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat