gamersam3123
gamersam3123 gamersam3123
  • 03-12-2020
  • Mathematics
contestada

A double line graph can compare the changes of two different things over a period of time. True or false

Respuesta :

s72226
s72226 s72226
  • 03-12-2020

Answer:

i think this is true because on a line graph nothing stays the same.

Step-by-step explanation:

If we start  line graph on the viruses that are going around the number of deaths and cases would change every day and every second

Answer Link
skyahbaker84
skyahbaker84 skyahbaker84
  • 03-12-2020

Answer:

true

Step-by-step explanation:

Answer Link

Otras preguntas

The right to a trial by jury in a criminal case is outlined in which amendment?
How to find the length of a triangle with only one side non right triangle?
You analyze a cell. the cell starts with two moles of glucose and you see five moles of pyruvate appear. how many atp were produced by glycolysis
if f(x)=4x-6, what is f(6)
which of the following countries did the u.s. lend-lease military equipment to A. Germany B. spain C.great britian D.italy
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Monocytes are a type of white blood cell that can differentiate into what two cells?
(50)points 5 questions!
Find f(x) if it is known that f(x−2)=2x−4.
A _____ reaction is one that consists of two or more elementary reactions. a. simple b. complex c. single d. double