mohammadalobed60 mohammadalobed60

04-09-2020
Mathematics

contestada

What percentage is the shaded area

What percentage is the shaded area class=

Respuesta :

Travisthanh Travisthanh

04-09-2020

Answer:

75%

Step-by-step explanation:

There are 4 parts and 3 are shaded

(3 /4)=75%

Answer Link

Otras preguntas

Helena has five different flowers. She plans to give one flower to each of her five teachers in any order. She gives the first flower to one of her teachers in

Find the area of a kite with diagonals 10 & 5

Researchers are exploring whether treatment with ________ might improve social behavior in those with asd.

Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new

15 points to whoever can answer this question!!!! Five countries are competing in the high jump at the Olympics. Each country reached a certain height ( meter

Adele earns about $15 each day in tips as a waitress. If she saves $7.50 of it, how many workings days will ot take her to save $225 ?

CAN SOMEONE HELP ME PLEASE ?

Public opinion in the united states tends to be more _____________ than political elites in areas such as religion in public schools, but more ______________ in

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Write a compound inequality that the graph could represent.