lewiscrash850 lewiscrash850
  • 02-09-2020
  • Mathematics
contestada

-3-(-8)-(-2)=Xggggggggggggggggggggggg

Respuesta :

Bitkoy
Bitkoy Bitkoy
  • 02-09-2020

Answer:

x is 7

Step-by-step explanation:

-3-(-8)-(-2) = x

             7 = x

Answer Link

Otras preguntas

The mean potassium content of a popular sports drink is listed as 138 mg in a 32-oz bottle. Analysis of 40 bottles indicates a sample mean of 136.9 mg. (a) Stat
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Which one of the following statements about gender and strength training is TRUE? 1. Men have a lower proportion of muscle overall than women. 2. Women tend to
Let F = sin ( 8 x + 5 z ) i − 8 y e x z k . F=sin⁡(8x+5z)i−8yexzk. Calculate div ( F ) div(F) and curl ( F ) . and curl(F). (Express numbers in exact form. Use
of the 300 students in 8th grade, 180 take PE, 80 take art. 72 take music, 33 take PE and art, 28 take PE and music, and 20 take all three classes M= all studen
Consider a transaction that has three parties: (1) JWCJR Corp. (JWCJR) and its owner, John W. Cumberledge, Jr., (2) Bottomline Systems, Inc., and (3) Colonial P
What landform covers much of central India?
Justice always prevails
Do 3/5 and 9/15 equal the same Whole?
A cube has a volume of 10 cm^3. A larger cube has a volume of x cm^3 . Consider the function f(x) =(x-10)cubed. What do the values f(19) and f(14) represent?