01-06-2020
Mathematics

contestada

For 10 points if good enough please help

For 10 points if good enough please help class=

Respuesta :

TooneatO TooneatO

01-06-2020

Answer:

$0.75

Step-by-step explanation:

convert 5000 milligrams to grams which is 5.

Then multiply 5 by 0.15 to get the price which is 0.75

Answer Link

Otras preguntas

Why might echinoderms make a more appropriate study species for making inferences about humans than other commonly studied species such as drosophila fruit flie

As a result of the educational reforms enacted in 1984, Texas schools offered A. lighter class loads. B. smaller class sizes. C. fewer assessment tests. D

Do you think social mobility is an easy thing to achieve in the US? Why or why not?

Why were senators able to amass more power and influence than congressmen during the gilded age?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

what is the most important factor that holds a gene pool of a species together and prevents speciation?

When a red blood cell is placed in hypotonic (very dilute) solutions of nacl?

Sequence the skeletal and muscular changes that take place when a person inhales

The _______ was Franklin Roosevelt's program designed to fight the Great Depression

If an employee gets potentially infectious material splashed in his eye, what should he do?