beserkerbradley7985 beserkerbradley7985
  • 03-02-2019
  • Biology
contestada

The process by which natural forces move weathered rock and soil brim one place to another is called

Respuesta :

emblemhacks
emblemhacks emblemhacks
  • 03-02-2019

The process by which natural forces move weathered rock and soil from one place to another is called erosion.

Answer Link

Otras preguntas

Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How many times does four go into 153 ? What Is the remainder ?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
What is the sum of 6/10 plus 7/12
who fought against each other in the crusades?
What kind of problems did increased urbanization cause? During time of industrial revolution
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
Please answer theses division problems!! 9 divided by 3/7