crystal12682pee8ij crystal12682pee8ij
  • 01-09-2018
  • Mathematics
contestada

what is the value of p in the equation P to the third power equals 8

Respuesta :

computing
computing computing
  • 01-09-2018
p = 2

**Please mark this answer as Brainliest and leave a Thanks if I helped :)
Answer Link
Аноним Аноним
  • 01-09-2018

p^3 = 8

2^3 = 8

sop must be 2   answer

Answer Link

Otras preguntas

What Role Does the Sun Play in Producing Winds And Ocean Currents
A generator stores electric current. Explain why you agree or disagree with this statement
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why did the french revolution happen and who's fault was it
2ln(5x)=8 solve for x
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.