Reskii Reskii
  • 01-08-2018
  • History
contestada

How did wealthy plantation owners fulfill their duty to fight

Respuesta :

cmazzaferri20 cmazzaferri20
  • 06-08-2018

If you are talking about the civil war then the answer is they could pay a three hundred dollar fine.

Answer Link

Otras preguntas

Give a recursive algorithm for finding the sum of the first n odd positive integers.
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
What would be the most likely effect of one company buying a competitor?
2ln(5x)=8 solve for x
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea